Mature sequence bra-miR5720

Accession numberMIMAT0023018
IDbra-miR5720
Stem-Loop bra-MIR5720
Sequence
uugugauuugguuggaauauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).