Mature sequence bra-miR5712

Accession numberMIMAT0023009
IDbra-miR5712
Stem-Loop bra-MIR5712
Sequence
aauauuaauauaauuggugag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).