Mature sequence mmu-miR-5132-3p

Accession numberMIMAT0022988
IDmmu-miR-5132-3p
Stem-Loop mmu-mir-5132
Sequence
cugauguuccccaucccgcag
Get sequence
Deep sequencing117 reads, 46 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).