Mature sequence hsa-miR-1292-3p

Accession numberMIMAT0022948
IDhsa-miR-1292-3p
Stem-Loop hsa-mir-1292
Sequence
ucgcgccccggcucccguuc
Get sequence
Deep sequencing31 reads, 19 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).