Mature sequence hsa-miR-1236-5p

Accession numberMIMAT0022945
IDhsa-miR-1236-5p
Stem-Loop hsa-mir-1236
Sequence
ugagugacaggggaaaugggga
Get sequence
Deep sequencing45 reads, 17 experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).