Mature sequence ptc-miR475b-5p

Accession numberMIMAT0022916
IDptc-miR475b-5p
Stem-Loop ptc-MIR475b
Sequence
aauggccauuguaagaguaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).