Mature sequence osa-miR156g-3p

Accession numberMIMAT0022848
IDosa-miR156g-3p
Stem-Loop osa-MIR156g
Sequence
gcucacuucucucucugucagc
Get sequence
Deep sequencing51 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).