Mature sequence sha-miR-199a

Accession numberMIMAT0022785
IDsha-miR-199a
Stem-Loop sha-mir-199a
Sequence
acaguagucugcacauugguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).