Mature sequence hsa-miR-1273g-3p

Accession numberMIMAT0022742
IDhsa-miR-1273g-3p
Stem-Loop hsa-mir-1273g
Sequence
accacugcacuccagccugag
Get sequence
Deep sequencing reads, experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).