Mature sequence hsa-miR-642b-5p

Accession numberMIMAT0022736
IDhsa-miR-642b-5p
Stem-Loop hsa-mir-642b
Sequence
gguucccucuccaaaugugucu
Get sequence
Deep sequencing548 reads, 95 experiments
Predicted targets

References

1