Mature sequence hsa-miR-548x-5p

Accession numberMIMAT0022733
IDhsa-miR-548x-5p
Stem-Loop hsa-mir-548x
Sequence
ugcaaaaguaauugcaguuuuug
Get sequence
Deep sequencing3956 reads, 121 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).