Mature sequence hsa-miR-513c-3p

Accession numberMIMAT0022728
IDhsa-miR-513c-3p
Stem-Loop hsa-mir-513c
Sequence
uaaauuucaccuuucugagaaga
Get sequence
Deep sequencing1423 reads, 35 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).