Mature sequence hsa-miR-506-5p

Accession numberMIMAT0022701
IDhsa-miR-506-5p
Stem-Loop hsa-mir-506
Sequence
uauucaggaagguguuacuuaa
Get sequence
Deep sequencing830 reads, 25 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).