Mature sequence hsa-miR-212-5p

Accession numberMIMAT0022695
IDhsa-miR-212-5p
Stem-Loop hsa-mir-212
Sequence
accuuggcucuagacugcuuacu
Get sequence
Deep sequencing3118 reads, 134 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).