Mature sequence hsa-miR-211-3p

Accession numberMIMAT0022694
IDhsa-miR-211-3p
Stem-Loop hsa-mir-211
Sequence
gcagggacagcaaaggggugc
Get sequence
Deep sequencing1520 reads, 15 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).