Mature sequence hvsa-miR-HSUR2-5p

Accession numberMIMAT0022686
IDhvsa-miR-HSUR2-5p
Stem-Loop hvsa-miR-HSUR2
Sequence
ucugugcucucaaggcuuuaaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21925386 "A primate herpesvirus uses the integrator complex to generate viral microRNAs" Cazalla D, Xie M, Steitz JA Mol Cell. 43:982-992(2011).