Mature sequence aau-miR396

Accession numberMIMAT0022674
IDaau-miR396
Stem-Loop aau-MIR396
Sequence
uuccacagcuuucuugaacug
Get sequence
Deep sequencing reads, experiments

References

1