Mature sequence ola-miR-143

Accession numberMIMAT0022668
IDola-miR-143
Stem-Loop ola-mir-143
Sequence
ugagaugaagcacuguagcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).