Mature sequence ola-miR-10b

Accession numberMIMAT0022651
IDola-miR-10b
Stem-Loop ola-mir-10b
Sequence
uacccuguagaaccgaauuugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).