Mature sequence ola-miR-10d

Accession numberMIMAT0022633
IDola-miR-10d
Stem-Loop ola-mir-10d
Sequence
uacccuguagaaccgaaugugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).