Mature sequence ola-miR-199a-3p

Accession numberMIMAT0022539
IDola-miR-199a-3p
Stem-Loop ola-mir-199a-1 ola-mir-199a-2 ola-mir-199a-3 ola-mir-199a-4
Sequence
acaguagucugcacauugguua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).