Mature sequence ssl-miR396

Accession numberMIMAT0022517
IDssl-miR396
Stem-Loop ssl-MIR396
Sequence
uuccacagcuuucuugaacug
Get sequence
Deep sequencing reads, experiments

References

1