Mature sequence mmu-miR-344i

Accession numberMIMAT0022503
IDmmu-miR-344i
Stem-Loop mmu-mir-344i
Sequence
aagucaggcuccuggcugga
Get sequence
Deep sequencing341 reads, 21 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21984899 "Neuronal activity regulates hippocampal miRNA expression" Eacker SM, Keuss MJ, Berezikov E, Dawson VL, Dawson TM PLoS One. 6:e25068(2011).