Mature sequence hsa-miR-5706

Accession numberMIMAT0022500
IDhsa-miR-5706
Stem-Loop hsa-mir-5706
Sequence
uucuggauaacaugcugaagcu
Get sequence
Deep sequencing91 reads, 51 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).