Mature sequence hsa-miR-5695

Accession numberMIMAT0022488
IDhsa-miR-5695
Stem-Loop hsa-mir-5695
Sequence
acuccaagaagaaucuagacag
Get sequence
Deep sequencing105 reads, 56 experiments
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).