Mature sequence gma-miR5678

Accession numberMIMAT0022466
IDgma-miR5678
Stem-Loop gma-MIR5678
Sequence
uuccaugauaagaucuuugac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).
2