Mature sequence gma-miR4387e

Accession numberMIMAT0022464
IDgma-miR4387e
Stem-Loop gma-MIR4387e
Sequence
uguuagugauaaggcgugaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).