Mature sequence gma-miR5674a

Accession numberMIMAT0022459
IDgma-miR5674a
Previous IDsgma-miR5674
Stem-Loop gma-MIR5674a
Sequence
uaauuguguuguacauuauca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).