Mature sequence gma-miR5037d

Accession numberMIMAT0022455
IDgma-miR5037d
Stem-Loop gma-MIR5037d
Sequence
cgggagccuaugaagguuaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).