Mature sequence gma-miR5668

Accession numberMIMAT0022450
IDgma-miR5668
Stem-Loop gma-MIR5668
Sequence
agcaauggaauuauagacugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).