Mature sequence mmu-miR-344h-3p

Accession numberMIMAT0022384
IDmmu-miR-344h-3p
Stem-Loop mmu-mir-344h-1 mmu-mir-344h-2
Sequence
gguauaaccaaagcccgacugu
Get sequence
Deep sequencing88 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).