Mature sequence cel-miR-356b-5p

Accession numberMIMAT0022311
IDcel-miR-356b-5p
Stem-Loop cel-mir-356b
Sequence
uggugagacacgucguaacgaau
Get sequence
Deep sequencing76 reads, 12 experiments
Database links
QuickGO function

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).