Mature sequence hsa-miR-5584-5p

Accession numberMIMAT0022283
IDhsa-miR-5584-5p
Stem-Loop hsa-mir-5584
Sequence
cagggaaaugggaagaacuaga
Get sequence
Deep sequencing408 reads, 29 experiments
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).