Mature sequence hsa-miR-548ar-5p

Accession numberMIMAT0022265
IDhsa-miR-548ar-5p
Stem-Loop hsa-mir-548ar
Sequence
aaaaguaauugcaguuuuugc
Get sequence
Deep sequencing3306 reads, 127 experiments
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).