Mature sequence hsa-miR-5571-5p

Accession numberMIMAT0022257
IDhsa-miR-5571-5p
Stem-Loop hsa-mir-5571
Sequence
caauucucaaaggagccuccc
Get sequence
Deep sequencing202 reads, 22 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21895886 "Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome" Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I Oral Dis. 18:127-131(2012).