Mature sequence hsa-miR-4524b-5p

Accession numberMIMAT0022255
IDhsa-miR-4524b-5p
Stem-Loop hsa-mir-4524b
Sequence
auagcagcauaagccugucuc
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:21895886 "Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome" Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I Oral Dis. 18:127-131(2012).