Mature sequence mtr-miR2592bn-3p

Accession numberMIMAT0022218
IDmtr-miR2592bn-3p
Previous IDsmtr-miR2592bn
Stem-Loop mtr-MIR2592bn
Sequence
ggaaaacaugaaugucgggug
Get sequence
Deep sequencing reads, experiments

References

1