Mature sequence mtr-miR2592bn-5p

Accession numberMIMAT0022217
IDmtr-miR2592bn-5p
Previous IDsmtr-miR2592bn*
Stem-Loop mtr-MIR2592bn
Sequence
cucggcauucauguuuuuccuu
Get sequence
Deep sequencing reads, experiments

References

1