Mature sequence mtr-miR5554a-3p

Accession numberMIMAT0022200
IDmtr-miR5554a-3p
Previous IDsmtr-miR5554a*
Stem-Loop mtr-MIR5554a
Sequence
accaucguugcagaugcucauc
Get sequence
Deep sequencing reads, experiments

References

1