Mature sequence mtr-miR5554a-5p

Accession numberMIMAT0022199
IDmtr-miR5554a-5p
Previous IDsmtr-miR5554a
Stem-Loop mtr-MIR5554a
Sequence
ugugcaucuugaacaaugguau
Get sequence
Deep sequencing reads, experiments

References

1