Mature sequence osa-miR5538

Accession numberMIMAT0022174
IDosa-miR5538
Stem-Loop osa-MIR5538
Sequence
acugaacucaaucacuugcugc
Get sequence
Deep sequencing1 reads, 1 experiments
Database links
QuickGO function

References

1