Mature sequence osa-miR5534b

Accession numberMIMAT0022170
IDosa-miR5534b
Stem-Loop osa-MIR5534b
Sequence
cgaugacaacagcuagaaugg
Get sequence
Deep sequencing1 reads, 1 experiments

References

1