Mature sequence osa-miR5532

Accession numberMIMAT0022167
IDosa-miR5532
Stem-Loop osa-MIR5532
Sequence
auggaauauaugacaaaggugg
Get sequence
Deep sequencing12 reads, 2 experiments
Database links
QuickGO function

References

1