Mature sequence osa-miR5521

Accession numberMIMAT0022155
IDosa-miR5521
Stem-Loop osa-MIR5521
Sequence
aguggcugcauaucugaugag
Get sequence
Deep sequencing reads, experiments

References

1