Mature sequence osa-miR5516a

• Accession number: MIMAT0022150
• ID: osa-miR5516a
• Previous IDs: osa-miR5516
• Stem-Loop: osa-MIR5516a
• Sequence: cucauugcuucgguaggcugg
• Deep sequencing: reads, experiments

References

1. PMID:21679406 "Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa" Wei LQ, Yan LF, Wang T Genome Biol. 12:R53(2011).
2. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).