Mature sequence osa-miR5512a

Accession numberMIMAT0022145
IDosa-miR5512a
Previous IDsosa-miR5512
Stem-Loop osa-MIR5512a
Sequence
uaggauaugguaaugcuaaaa
Get sequence
Deep sequencing33 reads, 2 experiments
Database links
QuickGO function

References

1