Mature sequence osa-miR5508

Accession numberMIMAT0022141
IDosa-miR5508
Stem-Loop osa-MIR5508
Sequence
uagauggcugaucuggugugg
Get sequence
Deep sequencing66 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).