Mature sequence osa-miR5506

Accession numberMIMAT0022139
IDosa-miR5506
Stem-Loop osa-MIR5506
Sequence
uggaucgcuucgucugauggu
Get sequence
Deep sequencing reads, experiments

References

1