Mature sequence osa-miR5499

Accession numberMIMAT0022132
IDosa-miR5499
Stem-Loop osa-MIR5499
Sequence
gaaggaagaaucguuauggaa
Get sequence
Deep sequencing reads, experiments

References

1