Mature sequence osa-miR5497

Accession numberMIMAT0022130
IDosa-miR5497
Stem-Loop osa-MIR5497
Sequence
cagaauaucugggacgagcau
Get sequence
Deep sequencing reads, experiments

References

1